phlsec expression vectors (Addgene inc)
Addgene inc is a verified supplier 
95
Structured Review
Addgene inc
phlsec expression vectors
Phlsec Expression Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 54 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/phlsec+expression+vectors/pHL-sec+(Plasmid+%2399845)/pmc13022285-96-0-4
Average 95 stars, based on 54 article reviews
Phlsec Expression Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 54 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/phlsec+expression+vectors/pHL-sec+(Plasmid+%2399845)/pmc13022285-96-0-4
Average 95 stars, based on 54 article reviews
phlsec expression vectors - by Bioz Stars,
2026-10
95/100 stars
Images
Related Articles
other:Article Title: Katacine Is a New Ligand of CLEC-2 that Acts as a Platelet Agonist Article Snippet: For the recombinant human CLEC-2–6xHis tag and human podoplanin-rabbit Fc vector overexpression, the extracellular domain of the cDNA of human CLEC-2 and podoplanin were cloned into a Expressing:Article Title: Structures of proteinase 3 and the CD177 receptor complex reveal a major autoantibody epitope Article Snippet: PCR primer: CD177 subI , reverse: TTTCCTATTGCAGTTCTCAGTCATACC , This study , . .. |